10.15468/lp7r84 https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_snow 647cb838-3294-4ee3-8ebc-a3a0075c7e5a http://ipt.biodiversity.aq/resource?r=bacteria_antarctic_snow Luigi Michaud University of Messina

Messina ITALY

Angelina Lo Giudice University of Messina

Messina ITALY

Mohamed Mysara Vrije Universiteit Brussel

Brussels BELGIUM

Pieter Monsieurs Belgian Nuclear Research Centre (SCK CEN)

Mol BELGIUM

Carmella Raffa University of Messina

Messina ITALY

Natalie Leys Belgian Nuclear Research Centre (SCK CEN)

Mol BELGIUM

Stefano Almafitano National Research Council (IRSA-CNR)

Rome ITALY

Rob Van Houdt Belgian Nuclear Research Centre (SCK CEN)

Mol BELGIUM

Maxime Sweetlove Royal Belgian Institute for Natural Sciences Research assistent

Rue Vautier 29 Brussels

msweetlove@naturalsciences.be 2019-03-19 ENGLISH Amplicon sequencing sample of Bacteria (16S ssu rRNA gene, v1-v3 region) from a snow sample taken from the "clean Area”, 2 km South from the Antarctic Research Base “Concordia” (75°06′S–123°20′E). Metadata GBIF Dataset Type Vocabulary: http://rs.gbif.org/vocabulary/gbif/dataset_type.xml This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License. Creative Commons Attribution 4.0 International https://spdx.org/licenses/CC-BY-4.0.html CC-BY-4.0 Antarctic snow surface sample collected in the “Clean Area” 2 km South from the Research Base “Concordia” (75°06′S–123°20′E) -123 -123 -75 -75 2010 2010 Bacteria (16S ssu rRNA gene, v1-v3 region) Domain Bacteria Bacteria unkown Luigi Michaud University of Messina

Messina ITALY

Angelina Lo Giudice University of Messina

Messina ITALY

Collected samples were allowed to thaw at 4°C for 24–48 h in the laboratory, with 100 litres of packed snow per sample resulting in approximately 20 litres of snowmelt. 15 L melted snow for DNA extraction was filtered through a 0.2-µm-pore-size Sterivex filter unit (Millipore). The filters were stored at −20°C in lysis buffer (50 mM tris, 40 mM EDTA, and 750 mM sucrose). Genomic DNA was extracted in triplicate using the phenol-chloroform method according to Zhou et al., and precipitated by adding 0.7 volumes of 100% isopropanol followed by a wash with ice-cold 70% ethanol. After air-drying, DNA was resuspended in 50 µl of deionizated sterile water. PCR of a bacterial 16S rRNA gene fragment (V1–V3 region, 507 bp) and subsequent tag-encoded pyrosequencing were performed at DNAVision (Charleroi, Belgium). The 16S rRNA genes were amplified using the two universal primers 8F (5′- AGAGTTTGATCCTGGCTCAG -3′) and 518R (5′- ATTACCGCGGCTGCTGG -3′). The forward primer contained the sequence of the Titanium A adaptor (5′-CCATCTCATCCCTGCGTGTCTCCGACTCAG-3′) and a barcode sequence. For each sample, a PCR mix of 100 µl was prepared containing 1×PCR buffer, 2U of KAPA HiFi Hotstart polymerase blend and dNTPs (Kapabiosystems), 300 nM primers (Eurogentec, Liege, Belgium), and 60 ng gDNA. Thermal cycling consisted of initial denaturation at 95°C for 5 min, followed by 25 cycles of denaturation at 98°C for 20 s, annealing at 56°C for 40 s, and extension at 72°C for 20 s, with a final extension of 5 min at 72°C. 3 µl of PCR product were added to a new PCR mix (identical as first round of PCR) for the nested PCR of 15 cycles. Amplicons were visualized on 1% agarose gels using GelGreen Nucleic Acid gel stain in 1× TAE (Biotium) and were cleaned using the Wizard SV Gel and PCR Clean-up System (Promega) according to the manufacturer's instructions. Pyrosequencing was carried out using the forward primer on a 454 Life Sciences Genome Sequencer FLX instrument (Roche) following titanium chemistry. Snow surface sample was collected in triplicate from a “Clean Area” 2 km from the Research Base “Concordia” (75°06′S–123°20′E) Sampling was performed by using polyethylene boxes pre-treated with 1M hydrogen chloride and hydrogen peroxide. Sterile gloves and suit, and an ethanol flame-sterilized shovel were used. Autoclave-sterilized Milli-Q water was treated in tandem with the snow samples as a negative-control field blank. Quantity and quality of extracted DNA was checked by nanodrop ND-1000 device and the Quant-iT PicoGreen dsDNA reagent and kit (Life Tech, Carlsbad, USA) following the manufacturer's instructions. Luigi Michaud ADMINISTRATIVE_POINT_OF_CONTACT Angelina Lo Giudice ADMINISTRATIVE_POINT_OF_CONTACT Support was given by the Italian “Programma Nazionale di Richerche in Antartide” (PNRA) and the MNA (Museo Nazionale dell'Antartide) 2026-04-24T07:19:14Z Michaud L, Lo Giudice A, Mysara M, Monsieurs P, Raffa C, Leys N, Almafitano S, Van Houdt R, Sweetlove M (2019). Bacteria (16S ssu rRNA) in an Antarctic snow sample. Version 1.2. SCAR - Microbial Antarctic Resource System. Metadata dataset https://doi.org/10.15468/lp7r84 accessed via GBIF.org on 2026-04-24. Michaud, L., Giudice, A. L., Mysara, M., Monsieurs, P., Raffa, C., Leys, N., ... & Van Houdt, R. (2014). Snow surface microbiome on the High Antarctic Plateau (DOME C). PloS one, 9(8), e104505.