10.15468/6pzeer https://ipt.biodiversity.aq/resource?r=bacteria_antarctic_glacial_foreland_soils 8e7cf0b8-4789-4b79-9dc9-33d65ed79918 http://ipt.biodiversity.aq/resource?r=bacteria_antarctic_glacial_foreland_soils Wenkai Yan Shanghai Jiao Tong University

Shanghai CHINA

Hongmei Ma Polar Research Institute of China

Shanghai CHINA

Guitao Shi Polar Research Institute of China

Shanghai CHINA

Bo Sun Polar Research Institute of China

Shanghai CHINA

Xiang Xiao Shanghai Jiao Tong University

Shanghai CHINA

Yu Zhang Shanghai Jiao Tong University

Shanghai CHINA

Maxime Sweetlove Royal Belgian Institute for Natural Sciences Research assistent

Rue Vautier 29 Brussels 1000 BELGIUM

msweetlove@naturalsciences.be 2019-03-19 ENGLISH Amplicon sequencing dataset (Illumina MiSeq) of Bacteria (16S ssu rRNA) in an Antarctic glacial foreland soil gradient Metadata GBIF Dataset Type Vocabulary: http://rs.gbif.org/vocabulary/gbif/dataset_type.xml This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License. Creative Commons Attribution 4.0 International https://spdx.org/licenses/CC-BY-4.0.html CC-BY-4.0 Soil samples were collected from the glacial foreland in Larsemann Hills in East Antarctica 76.407 76.407 -69 -69 Bacteria 16S ssu rRNA marker gene, v4 region Domain Bacteria Bacteria unkown Wenkai Yan Shanghai Jiao Tong University

Shanghai CHINA

Each soil sample was homogenized and sub-sampled for DNA extraction and geochemical measurements. An SDS-based method was employed to extract the DNA from soil (Natarajan et al., 2016). The bacterial V4 region of the 16S rRNA gene was amplified with a special bacterial primer pair 533F (TGCCAGCAGCCGCGGTAA)/Bact806R (GGACTACCAGGGTATCTAATCCTGTT). A sample tagging approach was employed, and a different barcode was added before the forward primer for each sample. The PCR reagents were mixed as follow: 5 μl of 10× Taq buffer (Takara, Otsu, Shiga, Japan), 4 μl of dNTP (Takara, Otsu, Shiga, Japan), 1 μl of each primer (10 μM stored concentration), 0.25 μl of Ex Taq DNA polymerase (Takara, Otsu, Shiga, Japan), approximately 50 ng of DNA, 2.5 μl of BSA (Bull Serum Albumin), and 32.75 μl of water. The PCR amplification consisted of an initial denaturation at 94°C for 5 min; 25 cycles of denaturation at 94°C for 40 s, annealing at 58°C for 40 s, and extension at 72°C for 1 min; and a final extension at 72°C for 8 min. The PCR products were purified with a Gel Extraction Kit (Omega Bio-Tek, Norcross, GA, United States) according to the manufacturer’s instructions. The reads were obtained with MiSeq sequencing platform (Illumina, San Diego, CA, United States). Soil samples were collected from the glacial foreland in Larsemann Hills in East Antarctica (-69.39762S, 76.40666 E), during the 29th Chinese National Antarctic Research Expedition in the Antarctic summer in February 2013. Surface soil layers, approximately 5 cm, were collected. When sites were covered by ice (3,4 and 5), the covering ice was gently cracked and the ice fractures were removed before sampling the soil beneath. The samples were stored in plastic bags and kept at -20°C during transport and storage in the laboratory until they were used for further analysis. Wenkai Yan ADMINISTRATIVE_POINT_OF_CONTACT Funding was provided by the National Natural Science Foundation of China (grants 41276202, 41476123, 41676177), China Ocean Mineral Resources R&D Association (grants DY125-22-04), and the thirteen Five-Year Plan for Polar Science (grants CHINARE 2016-02-02). 2026-04-10T10:16:29Z Yan W, Ma H, Shi G, Sun B, Xiao X, Zhang Y, Sweetlove M (2019). Bacteria in Antarctic glacial foreland soils. Version 1.3. SCAR - Microbial Antarctic Resource System. Metadata dataset https://doi.org/10.15468/6pzeer accessed via GBIF.org on 2026-04-10. Yan, W., Ma, H., Shi, G., Li, Y., Sun, B., Xiao, X., & Zhang, Y. (2017). Independent Shifts of Abundant and Rare Bacterial Populations across East Antarctica Glacial Foreland. Frontiers in microbiology, 8, 1534.