10.15468/q8fzq9 https://ipt.biodiversity.aq/resource?r=bacterial_diversity_antarctica_microbial_mats f3a8b1d6-a1d1-4292-8a7e-19c63a0825bd http://ipt.biodiversity.aq/resource?r=bacterial_diversity_antarctica_microbial_mats Bjorn Tytgat Ghent University Post doctoral assistent

Krijgslaan 281 Gent 9000 BELGIUM

bjorn.tytgat@ugent.be Elie Vrleyen Ghent University Professor

Krijgslaan 281 Gent 9000 BELGIUM

elie.verleyen@ugent.be Dagmar Obbels Ghent University PhD student

Krijgslaan 281 Gent 9000 BELGIUM

dagmar.obbels@ugent.be Karolien Peeters Ghent University Post doctoral researcher

Krijgslaan 281 Gent 9000 BELGIUM

Aake De Wever Royal Belgian Institute for Natural Sciences Post doctoral assistent

Krijgslaan 281 Brussels 1000 BELGIUM

Sofie D'hondt Ghent University Lab technician Tim De Meyer Ghent University Professor Wim van Criekinge GhentUniversity Post doctoral researcher Wim Vyverman Ghent University Professor Anne Willems Ghent Univeristy Professor Maxime Sweetlove Royal Belgian Institute for Natural Sciences

Rue Vautier 29 Brussels 1000 BELGIUM

msweetlove@naturalsciences.be Bjorn Tytgat Ghent University Post doctoral assistent

Krijgslaan 281 Gent 9000 BELGIUM

bjorn.tytgat@ugent.be CONTENT_PROVIDER Karolien Peeters Ghent University Post doctoral researcher

Gent 9000 BELGIUM

CONTENT_PROVIDER Anne Willems Ghent University Professor

Gent 9000 BELGIUM

anne.willems@ugent.be CONTENT_PROVIDER 2019-03-19 ENGLISH Bacterial data (16S rRNA) from terrestrial and aquatic Microbial mats in continental Antarctic. bacteria soil antarctica lake 16S GBIF Dataset Type Vocabulary: http://rs.gbif.org/vocabulary/gbif/dataset_type.xml This work is licensed under a Creative Commons Attribution (CC-BY) 4.0 License. Creative Commons Attribution 4.0 International https://spdx.org/licenses/CC-BY-4.0.html CC-BY-4.0 soil samples and lake samples from East Antarctica -67.45 39.8 -67.7 -80.45 2003 2007 Bacterial 16S amplicons (V1-V3 region) Domain Bacteria Bacteria unkown Bjorn Tytgat Ghent University Post doctoral assistent

Krijgslaan 281 Gent 9000 BELGIUM

bjorn.tytgat@ugent.be DNA was extracted from frozen samples using 5 g per sample. Extracellular DNA was first removed as described by Corinaldesi et al. and DNA extraction was subsequently performed according to Zwart et al. Sequencing of the 16S rRNA V1–V3 regions was performed using forward primer pA (AGAGTTTGATCCTGGCTCAG 8–27) and reverse primer BKL1 (GTATTACCGCGGCTGCTGGCA 536– 516). Because it proved impossible to concatenate the comple- mentary reads due to insufficient overlap, the forward and reverse sequences were analyzed separately. The forward reads hence cover the complete V1 and V2 regions, whereas the reverse reads cover the V3 and part of the V2 region for the longest sequences. Multiplexing was done with barcodes proposed by Parames- waran et al. Each PCR mixture contained 1–2 ml of template DNA, 2 ml of fusion primers and barcodes (10 mM), 2.5 ml dNTPs (10 mM), 1.5 ml of 10x buffer, 0.25 ml of 5 U/ml FastStart High Fidelity Polymerase (Roche) and was adjusted to a final volume of 25 ml with sterile HPLC-water. PCR cycling included 3 min at 94uC, followed by 35 cycles of 94uC for 30 s, 55uC for 60 s and 72uC for 90 s and finally 8 min at 72uC. PCR products were purified using a High Pure PCR Product Purification Kit (Roche). Pyrosequencing was performed on a Roche 454 GS FLX Titanium machine at NXTGNT (Ghent, Belgium) after quality control of the DNA with a Qubit 2.0 Fluorometer (Life Technologies) and a Bioanalyzer (Agilent Technologies). One sample (PQ1) was collected on Pourquoi-Pas Island off the west coast of Graham Land (Antarctic Peninsula). All other samples were collected from Eastern Antarctic habitats. The two terrestrial microbial mat samples (BB50 and BB115) were taken near the Utsteinen nunatak in the Sør Rondane Mountains (Dronning Maud Land). Three samples were from Lu ̈tzow-Holm Bay (Dronning Maud Land), namely from a small saline lake in Langhovde (LA3), from Naka-Tempyo Lake (SK5) in Skarvsnes, and from a small saline pond (WO10) in West Ongul Island. One sample (SO6) was taken from Lake Melkoye (unofficial name) in Schirmacher Oasis (Dronning Maud Land). The two remaining samples were collected in the Transantarctic Mountains. Sample TM2 was taken from Forlidas Pond (Dufek Massif, Pensacola Mountains), while sample TM4 was taken from Lundstro ̈m Lake (Shackleton Range). Two terrestrial and seven limnetic microbial mat samples were collected aseptically during different field campaigns in December/January 2003 (PQ1, TM2 and TM4) and in January 2007 (BB50, BB115, LA3, SK5, WO10 and SO6). All samples were kept frozen during transport and stored at 220uC. Bjorn Tytgat ADMINISTRATIVE_POINT_OF_CONTACT Elie Verleyen ADMINISTRATIVE_POINT_OF_CONTACT Dagmar Obbels ADMINISTRATIVE_POINT_OF_CONTACT Anne Willems ADMINISTRATIVE_POINT_OF_CONTACT Wim Vyverman ADMINISTRATIVE_POINT_OF_CONTACT CCAMBIO (Climate Change and Antarctic Microbial Biodiversity) is an academic project funded by the Belgian Federal Science Policy (BELSPO). Its main objective is to study the diversity, biogeographic zoning and genomic make-up of lacustrine microbial mat communities in the Antarctic Realm. CCAMBIO is composed by researchers from four Belgian Universities and Institutes (University of Liège, Ghent University, National Botanical Garden of Belgium and Royal Belgian Institute of Natural Sciences), as well as collaborators from the British Antarctic Survey. Belgian Science Policy Office (BelSPO) project SD/BA/03 2026-04-10T09:54:02Z Tytgat B, Vrleyen E, Obbels D, Peeters K, De Wever A, D'hondt S, De Meyer T, van Criekinge W, Vyverman W, Willems A, Sweetlove M (2019). Bacterial Diversity Assessment in Antarctic Terrestrial and Aquatic Microbial Mats. Version 1.1. SCAR - Microbial Antarctic Resource System. Metadata dataset https://doi.org/10.15468/q8fzq9 accessed via GBIF.org on 2026-04-10. Tytgat, B., Verleyen, E., Obbels, D., Peeters, K., De Wever, A., D’hondt, S., ... & Willems, A. (2014). Bacterial diversity assessment in Antarctic terrestrial and aquatic microbial mats: a comparison between bidirectional pyrosequencing and cultivation. PloS one, 9(6), e97564.